Print to Page   |   Contact Us   |   Report Abuse   |   Sign In   |   Register
Calendar of Events
Tell a Friend About This EventTell a Friend

"Sequentia," a solo exhibit at the Frost Art Museum
"Sequentia," a solo exhibit at the Frost Art Museum

10/13/2010 to 1/2/2011

When: October 13th, 2010 - January 2nd, 2011
Where: Patricia and Phillip Frost Art Museum
Florida International University
10975 SW 17th Street
Miami, Florida  33199
Contact:
Carol Damian, Director and Chief Curator

Details
Sequentia


Adenine | Cytosine | Guanine | Thymine | Main

Download Science magazine PDF

See wetheat.tv video


Sequentia

Xavier Cortada's solo exhibit at the Frost Art Museum explores the sequence of events that make up life on the planet from the molecular to the monumental.

The title of the exhibit also references a series of actions Cortada will set in motion to create of a unique strand of DNA. The artist will work with a molecular biologist to synthesize an actual DNA strand made from a sequence generated by museum visitors using Cortada’s art.


In The Four Nucleotides, the artist creates large scale "portraits” of Adenine, Cytosine, Guanine and Thymine-- the four bases of a DNA strand that summarize all we are, were and will be.


"Thymine," a painting by Xavier Cortada, 2010.
Xavier Cortada, "(The Four Nucleotides:) Thymine,"
oil on canvas, 60" x 48", 2010.


Xavier Cortada, "(The Four Nucleotides:) Adenine,"
acrylic on canvas, 60" x 72", 2010.


Xavier Cortada, Sequentia: Genetic Sequence, 2010


Participatory Installation

Genetic Sequence: Opening performance

In Genetic Sequence, the artist invites museum visitors to randomly select a post card depicting one of Cortada's four Nucleotide paintings and place them sequentially within small plastic bags hanging in a grid on a wall.

In placing the nucleotide postcards, the visitors will assist in the development of a DNA strand as part of a participatory installation.

above: screen grabs courtesy of wetheat.tv


LabARTory Sessions

LabARTory Session 2

Two weeks into the exhibit, the artist will engage in a series of LabARTory Sessions with Dr. Kalai Mathee, FIU Department of Molecular Microbiology and Infectious Diseases Founding Chair.

In her lab, Cortada will determine if the random sequence being generated by the participatory art project exists anywhere in the human genome.



LabARTory Sessions

During these performative sessions, Cortada will use the sequence to create a live DNA strand, insert (clone) it into a vector (plasmid) and propogate it in a bacteria on a Petri dish.

The presence of the specific DNA strand will also be analyzed using agarose gel electrophoresis, sequenced and analyzed against other existing DNA sequences.

As they become available, the results will be exhibited in the museum alongside the petri dish and a microfuge tube filled with the amplified DNA molecule.



"Guanine," a painting by Xavier Cortada, 2010.

Above: Xavier Cortada, "(The Four Nucleotides:) Guanine," acrylic on canvas, 60" x 72", 2010.


Results

TCTAATACAATCCCTACGTGACTGTGTATAAATGTGAAAGCTATATTAATGTCGCAGCTAGTCTCATAAAAGATTCCTACAACGCGACGGATCTATACCTATGCCATAGTCCCAGCTTTTACTTATTCTCACAATTTTACATTTTTGGGCCAACAGGACCGTCCTCATGCTTACCATATTCCTTCAGCTTAATATAGCTGATCTCTACACTCAAACCACCTCGTGTGCTGGTCTCGAGAGTTGCCCTTACCCGAGGCTTGGTGTACTGGGTGTAAGTAAAAGTTGGATAGGCCCGTCCTTGGAGACGTCGAACTAATTTTGAGAGCGCATCTGCTTCCATACTTGTATCCCTGTTGTCCTTCGGCACACGTGGAACTGACTTGCCTCAAAAAGGGTAACA

Was the random sequence (above) generated by the participatory art project similar to a DNA sequence found anywhere in the human genome?

Yes!  A portion of the sequence was similar to the portion of human Chromosome 3 which encodes for proteins that direct the navigation of axons in human neurons!

On November 10th, 2010, using the participants' sequence, Cortada synthesized the 400-nucleotide DNA molecule and named it "Sequentia."



"Cytosine," a painting by Xavier Cortada
Xavier Cortada, "(The Four Nucleotides:) Cytosine," oil on canvas, 60" x 48", 2010.


 
 
 

« Go to Upcoming Event List
Member Search
Sign In

Username

Password

Forgot your password?

Haven't registered yet?

Calendar

5/17/2012 » 8/12/2012
Turn Here (The Borowsky Gallery, Philadelphia)

©2008 Xavier Cortada. All text content, videos, and images denoted with copyright text are the property of Xavier Cortada.
Any reproductions, revisions or modifications of this website without expressed consent of Xavier Cortada is prohibited by law.