Print to Page   |   Contact Us   |   Report Abuse   |   Sign In   |   Register
Plenary Lecture: USF St. Petersburg Fall Genome Festival
Tell a Friend About This EventTell a Friend

Plenary Lecture: USF St. Petersburg Fall Genome Festival
Plenary Lecture: USF St. Petersburg Fall Genome Festival

11/3/2011

When: November 3rd, 2011
Reception at 6p; lecture at 7p
Where: Nelson Poynter Memorial Library
University of South Florida St. Petersburg
140 Seventh Avenue South,
St. Petersburg, Florida  33701-5016
United States
Contact:
Leon Hardy

Details
University of South Florida St. Petersburg
FALL GENOME FESTIVAL

In order to commemorate the 10th anniversary of the Human Genome Project, USFSP has invited Miami artist Xavier Cortada and Dr. Kalai Mathee (FIU Department of Molecular Microbiology and Infectious Diseases Founding Chair) to present a plenary lecture on November 3rd, 2011.  They will discuss "Sequentia," their 2010 DNA-themed multidisciplinary project at the Florida International University's Frost Art Museum (see below).
  
Cortada will conduct an art/science workshop with USFSP art students on the morning of November 3rd.  Cortada's DNA-themed art work will also be on display at the USF St. Petersburg Nelson Poynter Memorial Library. 


SEQUENTIA

Sequentia


Adenine | Cytosine | Guanine | Thymine | Main

Download Science magazine PDF


Sequentia

Xavier Cortada's solo exhibit at the Frost Art Museum explored the sequence of events that make up life on the planet from the molecular to the monumental.

The title of the exhibit also referenced a series of actions Cortada set in motion to create of a unique strand of DNA. The artist worked with a molecular biologist to synthesize an actual DNA strand made from a sequence generated by museum visitors using Cortada’s art.


In The Four Nucleotides, the artist created large scale "portraits” of Adenine, Cytosine, Guanine and Thymine-- the four bases of a DNA strand that summarize all we are, were and will be.


"Thymine," a painting by Xavier Cortada, 2010.
Xavier Cortada, "(The Four Nucleotides:) Thymine,"
oil on canvas, 60" x 48", 2010.


Xavier Cortada, "(The Four Nucleotides:) Adenine,"
acrylic on canvas, 60" x 72", 2010.


Xavier Cortada, Sequentia: Genetic Sequence, 2010


Participatory Installation

Genetic Sequence: Opening performance

In Genetic Sequence, the artist invited museum visitors to randomly select a post card depicting one of Cortada's four nucleotide paintings and place them sequentially within small plastic bags hanging in a grid on a wall.

In placing the nucleotide postcards, the visitors assisted in the development of a DNA strand as part of a participatory installation.

above: screen grabs courtesy of wetheat.tv


LabARTory Sessions

LabARTory Session 2

Two weeks into the exhibit, the artist engaged in a series of LabARTory Sessions with Dr. Kalai Mathee, FIU Department of Molecular Microbiology and Infectious Diseases Founding Chair.

In her lab, Cortada determined whether or not the random sequence being generated by the participatory art project existed anywhere in the human genome.



LabARTory Sessions


During these performative sessions, Cortada used the sequence to create a live DNA strand, inserted (cloned) it into a vector (plasmid) and propogated it in a bacteria on a Petri dish.

The presence of the specific DNA strand was also analyzed using agarose gel electrophoresis, sequenced and analyzed against other existing DNA sequences.

Once they became available, the results were exhibited in the museum alongside the Petri dish and a microfuge tube filled with the amplified DNA molecule.



"Guanine," a painting by Xavier Cortada, 2010.

Above: Xavier Cortada, "(The Four Nucleotides:) Guanine," acrylic on canvas, 60" x 72", 2010.


Results

TCTAATACAATCCCTACGTGACTGTGTATAAATGTGAAAGCTATATTAATGTCGCAGCTAGTCTCATAAAAGATTCCTACAACGCGACGGATCTATACCTATGCCATAGTCCCAGCTTTTACTTATTCTCACAATTTTACATTTTTGGGCCAACAGGACCGTCCTCATGCTTACCATATTCCTTCAGCTTAATATAGCTGATCTCTACACTCAAACCACCTCGTGTGCTGGTCTCGAGAGTTGCCCTTACCCGAGGCTTGGTGTACTGGGTGTAAGTAAAAGTTGGATAGGCCCGTCCTTGGAGACGTCGAACTAATTTTGAGAGCGCATCTGCTTCCATACTTGTATCCCTGTTGTCCTTCGGCACACGTGGAACTGACTTGCCTCAAAAAGGGTAACA

Was the random sequence (above) generated by the participatory art project similar to a DNA sequence found anywhere in the human genome?

Yes!  A portion of the sequence was similar to the portion of human Chromosome 3 which encodes for proteins that direct the navigation of axons in human neurons!

On November 10th, 2010, using the participants' sequence, Cortada synthesized the 400-nucleotide DNA molecule and named it "Sequentia."



"Cytosine," a painting by Xavier Cortada
Xavier Cortada, "(The Four Nucleotides:) Cytosine," oil on canvas, 60" x 48", 2010.


 
 

« Go to Upcoming Event List
Calendar

9/17/2012 » 5/31/2013
Tallahassee exhibit: Artistic Representations of Florida Throughout 500 Years | Gallery

2/28/2013 » 6/15/2013
Ecological Reflections Exhibit at NSF Headquarters

3/29/2013 » 6/22/2013
Exhibit: "The Quest for the Fountain of Youth in Florida History, Mythology and Art"

8/23/2013
FLOR500 Project in Amelia Center Gallery at Gulf Coast State College (Panama City, Florida)



FIU College of Architecture + The Arts


Xavier Cortada
Artist-in-Residence
FIU College of Architecture + The Arts
Miami Beach Urban Studios
420 Lincoln Road, Suite 440
Miami Beach, FL 33139

Xavier Cortada's participatory art practice is based at Florida International University.

 Reclamation Project 


FLOR500

 

Native Flags

 





Xavier Cortada created art installations at the North Pole and South Pole to address environmental concerns at every point in between. He’s been commissioned to create art for the White House, the World Bank, Miami City Hall, Miami-Dade County Hall, Florida Botanical Gardens, the Miami Art Museum, Museum of Florida History, Miami Science Museum and the Frost Art Museum. Cortada has also developed numerous collaborative art projects globally, including peace murals in Cyprus and Northern Ireland, child welfare murals in Bolivia and Panama, AIDS murals in Switzerland and South Africa, and eco-art projects in Holland, Hawaii, New HampshireLatvia and Taiwan. Cortada serves as artist-in-residence at the FIU College of Architecture + The Arts.


 

facebook

twiiter.com/xcortada
 


©2008-2013 Xavier Cortada. All text content, videos, and images are the property of Xavier Cortada.


Any reproductions, revisions or modifications of this website without expressed consent of Xavier Cortada is prohibited by law.